Sequence ID | >WENV170722370 |
Genome ID | LSQX01227255 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 16621 |
End posion on genome | 16693 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ggtaccaggT |
tRNA gene sequence |
GCGATAGTAGTCTAGCGGTAGGACAGGGGCTTCCCAAGCCTCTAGCCCGGGTTCGATTCC |
Downstream region at tRNA end position |
cgtttttttt |
Secondary structure (Cloverleaf model) | >WENV170722370 Gly CCC T ATgc cgtttttttt G - C C - G G - C A - T T - A A - T G - C T T T G G C C C A G A A | | | | | G C T C T G C C G G G C G + | | | T T G G G A C T A A TAGC G - C G + T G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |