Sequence ID | >WENV170722410 |
Genome ID | LSQX01228678 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 31713 |
End posion on genome | 31639 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
gaaattttct |
tRNA gene sequence |
GGGGACGTAGCTCAGGGGGAGAGCGCTTGACTCACATTCAAGAGGTCGGAGGTTCAAATC |
Downstream region at tRNA end position |
gtaaagtgaa |
Secondary structure (Cloverleaf model) | >WENV170722410 Val CAC t ACCA gtaaagtgaa G - C G - C G - C G - C A - T C - G G - C T A T T C T C C A G A A + | | | | A G C T C G G G A G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A G - C A - T C T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |