Sequence ID | >WENV170722449 |
Genome ID | LSQX01229806 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 131784 |
End posion on genome | 131859 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gttgcatgat |
tRNA gene sequence |
GAGCCATTAGCTCAGTCGGTAGAGCACCGGACTTTTAATCCGGGTGTCCCGCGTTCGAGT |
Downstream region at tRNA end position |
tttaaatata |
Secondary structure (Cloverleaf model) | >WENV170722449 Lys TTT t ACCA tttaaatata G - C A - T G - C C - G C - G A - T T - A T G T G G C G C A T G A A | | | | | G C C T C G C C G C G C G | | | | T T G G A G C T A A GTGTC C - G C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |