Sequence ID | >WENV170722666 |
Genome ID | LSQX01238215 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 16972 |
End posion on genome | 17046 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tagatgacga |
tRNA gene sequence |
GCGGAAGTAGCTCAGTGGTAGAGCATCGCCTTGCCAAGGCGAGGGTCGCGGGTTCGAATC |
Downstream region at tRNA end position |
tttttataag |
Secondary structure (Cloverleaf model) | >WENV170722666 Gly GCC a TCCA tttttataag G - C C - G G - C G - C A - T A - T G + T T A T T G C C C A G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G G - C C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |