Sequence ID | >WENV170722689 |
Genome ID | LSQX01239221 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2266 |
End posion on genome | 2191 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ccacatgtgt |
tRNA gene sequence |
GGGCGCTTAGCTCAGCTGGGAGAGCACCTGCCTTACAAGCAGGGGGTCATAGGTTCGAGC |
Downstream region at tRNA end position |
ttagctttac |
Secondary structure (Cloverleaf model) | >WENV170722689 Val TAC t ACCA ttagctttac G - C G - C G - C C T G + T C - G T T C G T T A T C C A C G A A | | | | | G T C T C G A T A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |