Sequence ID | >WENV170722787 |
Genome ID | LSQX01242973 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 30872 |
End posion on genome | 30947 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gctttcttat |
tRNA gene sequence |
TCCCCGATAGCTCAGACGGTAGAGCGACGGACTGTTAATCCGCAGGTCACTGGTTCGATC |
Downstream region at tRNA end position |
aaattcaaaa |
Secondary structure (Cloverleaf model) | >WENV170722787 Asn GTT t GCCA aaattcaaaa T - A C - G C - G C - G C - G G - C A - T C T T T G A C C A A G A A | | | | | G C C T C G A C T G G C G | | | | T T G G A G C T A G AGGTC A C C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |