Sequence ID | >WENV170723135 |
Genome ID | LSQX01256412 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 3415 |
End posion on genome | 3326 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cagagggtcc |
tRNA gene sequence |
GGATGGGTGGCCGAGTGGTTTAAGGCACCGGTCTTGAAAACCGGCGTGGGTTCACGCCCA |
Downstream region at tRNA end position |
gaccaacggc |
Secondary structure (Cloverleaf model) | >WENV170723135 Ser TGA c GCCA gaccaacggc G - C G - C A - T T - A G - C G - C G - C T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C T T A A CGTGGGTTCACGCCCACC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |