Sequence ID | >WENV170723142 |
Genome ID | LSQX01256541 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 134221 |
End posion on genome | 134297 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tagttgctgt |
tRNA gene sequence |
GGCAGCGTAGCTCAGTTGGTTAGAGCGTAGGACTCATAAGCCTAAGGTCACAGGTTCAAT |
Downstream region at tRNA end position |
aatcgacttt |
Secondary structure (Cloverleaf model) | >WENV170723142 Met CAT t ACCA aatcgacttt G + T G - C C - G A - T G - C C - G G - C C T T T G T C C A T G A A | | | | | A T C T C G A C A G G C G | | | | T T G G A G C T T A G AGGTC T - A A - T G - C G - C A G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |