Sequence ID | >WENV170723176 |
Genome ID | LSQX01257633 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 30541 |
End posion on genome | 30456 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
caacattagt |
tRNA gene sequence |
GCGAGGGTTGCCCAGCCAGGTCAAAGGCGATGGGCTTAGGACCCATTTTCGTAGGAATTC |
Downstream region at tRNA end position |
atatttaaag |
Secondary structure (Cloverleaf model) | >WENV170723176 Leu TAG t ACtt atatttaaag G - C C - G G - C A - T G - C G - C G - C T A T C A C G C A C C G A T | | | | | G A C C C G G T G C G C G | | | T T G A G G C T C A A G TTTCGTAGGAATTC A - T T - A G - C G - C G - C C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |