Sequence ID | >WENV170723191 |
Genome ID | LSQX01258291 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 33501 |
End posion on genome | 33588 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
agtgtcacca |
tRNA gene sequence |
GCCCGGATGGTGGAATTGGTAGACACCCAGGACTTAAAATCCTGTGGCCATTGCGGCCGT |
Downstream region at tRNA end position |
aagccccgtc |
Secondary structure (Cloverleaf model) | >WENV170723191 Leu TAA a ACAA aagccccgtc G + T C - G C - G C - G G - C G - C A - T C G T C G G C C A T A A G | | | | | G T G G T G G C C G G C G | | | T T G A C A C T A G C TGGCCATTGCGGCCGT C - G A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |