Sequence ID | >WENV170723464 |
Genome ID | LSQX01269272 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2071 |
End posion on genome | 2145 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
agtatattat |
tRNA gene sequence |
TGGGGTGTCGTCAAGCGGTAAGACACGGGCCTTTGGAGCCCGCATTCGGAGGTTCGAATC |
Downstream region at tRNA end position |
ttgtgaatat |
Secondary structure (Cloverleaf model) | >WENV170723464 Gln TTG t GCCA ttgtgaatat T - A G - C G - C G - C G - C T - A G - C T A T C C T C C A G A C | | | | | G C A C T G G G A G G C G | | | T T G A G A C T A A CATTC C - G G - C G - C G - C C - G C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |