Sequence ID | >WENV170723592 |
Genome ID | LSQX01274518 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2415 |
End posion on genome | 2342 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gcgcagcgct |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCAGAAGCTTCCCAAGCTTACGACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
gtttcgacaa |
Secondary structure (Cloverleaf model) | >WENV170723592 Gly CCC t TCCA gtttcgacaa G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A A CGAC G A A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |