Sequence ID | >WENV170723966 |
Genome ID | LSQX01287462 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 26338 |
End posion on genome | 26412 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aggtgcttga |
tRNA gene sequence |
GGCGGCATAGCCAAGTGGTAAGGCAGAGCTCTGCAAAAGCTCCACTCCCCGGTTCAAATC |
Downstream region at tRNA end position |
ttgatgcagt |
Secondary structure (Cloverleaf model) | >WENV170723966 Cys GCA a TCCA ttgatgcagt G - C G - C C - G G - C G - C C - G A - T T A T G G G C C A G A A | | | | | A T A C C G C C C G G C G | | | T T G A G G C T A A CACTC G - C A - T G - C C - G T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |