Sequence ID | >WENV170724032 |
Genome ID | LSQX01290450 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1186 |
End posion on genome | 1100 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
agttcaatgT |
tRNA gene sequence |
GACGAGATAGCCAAGCCCGGTATGGCGCGGGATTGCTAATCCCGTGATGCTCCGCATCCC |
Downstream region at tRNA end position |
cttttttaat |
Secondary structure (Cloverleaf model) | >WENV170724032 Ser GCT T GTtt cttttttaat G - C A - T C - G G - C A - T G - C A - T T G T C C C C C A C G A A | | | | | G C A C C G G G G G G C C | | | | T T G T G G C G T A G TGATGCTCCGCATCCC C - G G - C G - C G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |