Sequence ID | >WENV170724077 |
Genome ID | LSQX01292363 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 13525 |
End posion on genome | 13600 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
taacttcttt |
tRNA gene sequence |
GGCCAGGTAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTTGTGTCGGGAGTTCGATT |
Downstream region at tRNA end position |
gatttaagag |
Secondary structure (Cloverleaf model) | >WENV170724077 Phe GAA t ACCA gatttaagag G - C G - C C - G C - G A A G - C G - C T T T C C C T C A T G A A | | | | | G C C T C G G G G A G C G | | | | T T G G A G C T A A GTGTC G + T A - T G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |