Sequence ID | >WENV170724243 |
Genome ID | LSQX01298122 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2161 |
End posion on genome | 2074 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
agtatcaggc |
tRNA gene sequence |
GCGAGGGTTGCCAAGCCAGGTCAAAGGCGATAGGTTCAGGGCCTATTCTCGTAGGAGTTC |
Downstream region at tRNA end position |
tttctttgat |
Secondary structure (Cloverleaf model) | >WENV170724243 Leu CAG c ACTA tttctttgat G - C C - G G - C A - T G - C G - C G + T T A T C G G C C A C C G A T | | | | | G A A C C G G C C G G C G | | | T T G A G G C T C A A G TCTCGTAGGAGTTC A - T T - A A - T G - C G - C T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |