Sequence ID | >WENV170724393 |
Genome ID | LSQX01303866 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 32002 |
End posion on genome | 31927 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ataataacaa |
tRNA gene sequence |
GCCGCTTTAGCTCAGTCGGTAGAGCAGTTCATTCGTAATGAAAAGGTCGCCAGTTCGATT |
Downstream region at tRNA end position |
ataacaacaa |
Secondary structure (Cloverleaf model) | >WENV170724393 Thr CGT a ACCA ataacaacaa G - C C - G C - G G - C C - G T - A T - A T T T C G G C C A T G A A | | | | G C C T C G G C C A G C G | | | | T T G G A G C T A A AGGTC G A T - A T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |