Sequence ID | >WENV170724394 |
Genome ID | LSQX01303875 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 35 |
End posion on genome | 117 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttattataac |
tRNA gene sequence |
GCCCAGATGGCGTAATTCGGAGACGCGCTGGTCTCAAACACCAGTGGAGCAATCCATCCC |
Downstream region at tRNA end position |
agtagatccc |
Secondary structure (Cloverleaf model) | >WENV170724394 Leu CAA c ACtg agtagatccc G + T C - G C - G C - G A - T G - C A - T C T T G G G C C A T A A G | | | | | G T T G C G C C C G G C C | | | | T T G A C G C G A G G TGGAGCAATCCAT C - G T - A G - C G - C T - A C C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |