Sequence ID | >WENV170724446 |
Genome ID | LSQX01305970 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 12619 |
End posion on genome | 12694 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gctaaacact |
tRNA gene sequence |
GGCCCGTTGGAGAAACGGTTAACTCACATGCCTTTCACGCATGCATTCACGGGTTCGAAT |
Downstream region at tRNA end position |
aacgctgata |
Secondary structure (Cloverleaf model) | >WENV170724446 Glu TTC t ACCA aacgctgata G - C G + T C - G C - G C - G G - C T - A T A T T G C C C A C A A G | | | | | G G A G A G A C G G G C G | | | T T T A C T C T A A CATTC C - G A - T T - A G - C C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |