Sequence ID | >WENV170724557 |
Genome ID | LSQX01309576 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 13903 |
End posion on genome | 13830 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tccgctccat |
tRNA gene sequence |
GCCGATGTAGTTCAATGGTAGAACTCCTGCTTCCCAAGCAGGCGGCGCGGGTTCGATTCC |
Downstream region at tRNA end position |
acgcttcacg |
Secondary structure (Cloverleaf model) | >WENV170724557 Gly CCC t TCCA acgcttcacg G - C C - G C - G G - C A - T T - A G - C T T T T G C C C A A A A + | | | | G T C T T G G C G G G C G | | | | T T G G A A C T A T CGGC C - G C - G T - A G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |