Sequence ID | >WENV170724916 |
Genome ID | LSQX01323601 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 14703 |
End posion on genome | 14788 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gtagaagcag |
tRNA gene sequence |
GCCGGGATAGTCTAGTCTGGTAAGGCGGTGGCCTTGAAAGCCACTGGTGCCTGGCACCTC |
Downstream region at tRNA end position |
tgatatatcc |
Secondary structure (Cloverleaf model) | >WENV170724916 Ser TGA g GCtt tgatatatcc G - C C - G C - G G - C G - C G - C A - T T A T C C C T C A T G A A | | | | | A C T C T G G G G A G C T | | + | T T G A G G C G T A G TGGTGCCTGGCACCTC G - C T - A G - C G - C C - G C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |