Sequence ID | >WENV170724947 |
Genome ID | LSQX01324470 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 34199 |
End posion on genome | 34125 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccagaattat |
tRNA gene sequence |
GGCCCCTTGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACAGGAGTTCGAGTC |
Downstream region at tRNA end position |
tttgttttta |
Secondary structure (Cloverleaf model) | >WENV170724947 Glu TTC t ACCA tttgttttta G - C G + T C - G C - G C - G C - G T - A T G T T C C T C A C G A G | | | | | G G A C T G A G G A G C G | | | T T T A G A C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |