Sequence ID | >WENV170724961 |
Genome ID | LSQX01325067 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 5613 |
End posion on genome | 5532 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
taatcaaaaT |
tRNA gene sequence |
GCCCAGGTCGTCTAGCGGTATGGCGACGGTCTCGAAAACCGTTCCCCTTGGGATCGCAGG |
Downstream region at tRNA end position |
ttttcaggat |
Secondary structure (Cloverleaf model) | >WENV170724961 Ser CGA T GTaa ttttcaggat G - C C - G C - G C - G A - T G - C G - C T A T C G T C C A G A C | | | | | G C T C T G G C A G G C G | + | T T G T G G C T A G TCCCCTTGGGATC A - T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |