Sequence ID | >WENV170725047 |
Genome ID | LSQX01328766 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 11040 |
End posion on genome | 10965 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tctgcacaac |
tRNA gene sequence |
GCCGGCATAGCTCAGTTGGTAGAGCAACTGACTTGTAATCAGTAGGTCCACAGTTCGAAT |
Downstream region at tRNA end position |
tattaaacct |
Secondary structure (Cloverleaf model) | >WENV170725047 Thr TGT c ACCA tattaaacct G - C C - G C - G G - C G - C C - G A - T T A T G T G C C A T G A A | | | | G T C T C G C A C A G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |