Sequence ID | >WENV170725657 |
Genome ID | LSQX01351558 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 33808 |
End posion on genome | 33736 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
catctcttgc |
tRNA gene sequence |
GGGCGCGTAGATCAGGGGCAGATCGTTGCGTTCGCAACGCAAAGGCCGCGGGTTCAAATC |
Downstream region at tRNA end position |
ctctttgtca |
Secondary structure (Cloverleaf model) | >WENV170725657 Ala CGC c ACtc ctctttgtca G - C G - C G + T C - G G A C - G G - C T A T C G C C C A G A A | | | | | A G C T A G G C G G G C G | | | | T T G G A T C C A G AGGCC T - A T - A G - C C - G G - C T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |