Sequence ID | >WENV170725736 |
Genome ID | LSQX01354079 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 5741 |
End posion on genome | 5667 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gacgatggtt |
tRNA gene sequence |
TGGGGCGTAGCCAAGTGGTAAGGCACGGGACTTTGGATCCCGCATTCGAAGGTTCGAACC |
Downstream region at tRNA end position |
atctagcgta |
Secondary structure (Cloverleaf model) | >WENV170725736 Gln TTG t GCCA atctagcgta T - A G - C G - C G - C G - C C - G G - C C A T C T T C C A G A A | | | | | G T A C C G G A A G G C G | | | T T G A G G C T A A CATTC C - G G - C G - C G - C A - T C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |