Sequence ID | >WENV170725749 |
Genome ID | LSQX01354792 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 137148 |
End posion on genome | 137062 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gccgataaat |
tRNA gene sequence |
GCGGATATGGCGGAATTGGCAGACGCGCCAGATTCAGGTTCTGGTCGGGGCAACTCGGTG |
Downstream region at tRNA end position |
aaccactctg |
Secondary structure (Cloverleaf model) | >WENV170725749 Leu CAG t ACCA aaccactctg G - C C - G G - C G - C A - T T - A A - T T G T T C T C C A T A A G + | | | | A T G G C G G G A G G C G | | | T T G A C G C C A G G TCGGGGCAACTCGGT C - G C - G A - T G - C A - T T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |