Sequence ID | >WENV170725756 |
Genome ID | LSQX01355291 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1791 |
End posion on genome | 1719 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
aaatccatag |
tRNA gene sequence |
GGGCCGGTGGTCTAGGGGTATGATACCTCGCTCACAACGAGGTGGTCACGAGTTCGAATC |
Downstream region at tRNA end position |
gaccttttat |
Secondary structure (Cloverleaf model) | >WENV170725756 Val CAC g ACtg gaccttttat G - C G - C G - C C - G C - G G - C G - C T A T T G C T C A G A G | | | | | G G T C T G A C G A G C G | | + T T G T G A T T A A TGGTC C - G C - G T - A C - G G - C C A T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |