Sequence ID | >WENV170725942 |
Genome ID | LSQX01361746 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2508 |
End posion on genome | 2591 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cccggacgtc |
tRNA gene sequence |
GGGCGACGTGCTGCAAGGTGCGGCAGCGGACTGTAACTCCGCCGGGGAGACCCATGCCTG |
Downstream region at tRNA end position |
tcctccacca |
Secondary structure (Cloverleaf model) | >WENV170725942 Tyr GTA c ACCA tcctccacca G - C G - C G - C C - G G - C A - T C - G T T G G G A C C A A C T | | | | | G A G T C G C C T G G C G | + | | T T G C G G C T G A CGGGGAGACCCATG G - C C - G G - C G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |