Sequence ID | >WENV170726056 |
Genome ID | LSQX01365869 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 366 |
End posion on genome | 282 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tgagaaagat |
tRNA gene sequence |
GCGATTGTGGTGGAATTGGTAGACACGCCATCTTGAGGGGGTGGTGGCGCAAGCTGTGGG |
Downstream region at tRNA end position |
agctttattt |
Secondary structure (Cloverleaf model) | >WENV170726056 Leu GAG t ACCA agctttattt G - C C - G G - C A - T T - A T - A G - C T G T C C C C C A T A A G | | | | | A T G G T G G G G G G C G | | | T T G A C A C T A G G TGGCGCAAGCTGT C - G C - G A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |