Sequence ID | >WENV170726089 |
Genome ID | LSQX01367474 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 11181 |
End posion on genome | 11255 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
acatgcttgc |
tRNA gene sequence |
GCGGGATTAACTCAGTGGTAGAGTGTCACCTTGCCAAGGTGAAAGTCGCGAGTTCGAATC |
Downstream region at tRNA end position |
agaaggatga |
Secondary structure (Cloverleaf model) | >WENV170726089 Gly GCC c TCCA agaaggatga G - C C - G G - C G - C G - C A - T T - A T A T T G C T C A G A A + | | | | G T C T C A G C G A G C G | | | | T T G G A G T T A G AAGTC T - A C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |