Sequence ID | >WENV170726150 |
Genome ID | LSQX01369038 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 20764 |
End posion on genome | 20854 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
caccaggact |
tRNA gene sequence |
GGAAGCTTGGCAGAGCGGTTGAATGCACCGGTCTTGAAAACCGGCGAGGGTTAATAGCCC |
Downstream region at tRNA end position |
gatatttaaa |
Secondary structure (Cloverleaf model) | >WENV170726150 Ser TGA t GCCA gatatttaaa G - C G - C A - T A - T G - C C - G T - A T A T C A C T C A C G A G | | | | | G G G A C G G T G A G C G | | | T T T A T G C T G A A CGAGGGTTAATAGCCCTCC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |