Sequence ID | >WENV170726462 |
Genome ID | LSQX01381397 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 20624 |
End posion on genome | 20700 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aagattaaaa |
tRNA gene sequence |
GCCGGCATAGCTCAGTTGGCCAGAGCACGTGATTTGTAATCTCGGGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
tttaattgga |
Secondary structure (Cloverleaf model) | >WENV170726462 Thr TGT a TCGA tttaattgga G - C C - G C - G G - C G - C C - G A - T T A T C T C C C A T G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C C C A A GGGTC C - G G - C T T G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |