Sequence ID | >WENV170726662 |
Genome ID | LSQX01389193 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2740 |
End posion on genome | 2813 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tgaacctttt |
tRNA gene sequence |
GGTCGGTTGACCGAGTGGCTAGGTAGCGGTCTGCAAAACCGTGTACGGCGGTTCGACTCC |
Downstream region at tRNA end position |
aaatcccggc |
Secondary structure (Cloverleaf model) | >WENV170726662 Cys GCA t TCAA aaatcccggc G - C G - C T - A C - G G - C G - C T - A T C T C C G C C A G A G | | | | | G T G C C A G G C G G C G | | | T T G A G G T C T A GTAC G + T C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |