Sequence ID | >WENV170726695 |
Genome ID | LSQX01390502 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 10124 |
End posion on genome | 10039 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gagtaatttt |
tRNA gene sequence |
GCCGAGGTGGTGGAATTGGTAGACACGCTACCTTGAGGTGGTAGTGGCCATAGGCTGTAG |
Downstream region at tRNA end position |
tatatcaagc |
Secondary structure (Cloverleaf model) | >WENV170726695 Leu GAG t ACCA tatatcaagc G + T C - G C - G G - C A - T G - C G + T T G T T C C C C A T A A G | | | | | G T G G T G A G G G G C G | | | T T G A C A C T A G G TGGCCATAGGCTGT C - G T - A A - T C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |