Sequence ID | >WENV170726738 |
Genome ID | LSQX01392477 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2112 |
End posion on genome | 2196 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
acagaatcgc |
tRNA gene sequence |
GCGAGAGTTGCCAAGCCAGGTCAAAGGCGCCAGGTTCAGGGCCTGGTCTCGTAGGAGTTC |
Downstream region at tRNA end position |
gttttttgag |
Secondary structure (Cloverleaf model) | >WENV170726738 Leu CAG c Atac gttttttgag G - C C - G G - C A - T G - C A - T G - C T A T C G G C C A C C G A T | | | | | G A A C C G G C C G G C G | | | T T G A G G C T C A A G TCTCGTAGGAGTTC C - G C - G A - T G - C G - C T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |