Sequence ID | >WENV170726912 |
Genome ID | LSQX01398646 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 74 |
End posion on genome | 158 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttatagatgt |
tRNA gene sequence |
GCGAGCGTGGCGGAATTGGTAGACGCACTGGATTTAGGTTCCAGCGCCGTGAGGTGTGAG |
Downstream region at tRNA end position |
cataaatttt |
Secondary structure (Cloverleaf model) | >WENV170726912 Leu TAG t ACCA cataaatttt G - C C - G G - C A - T G - C C - G G - C T G T C T C T C A T A A G | | | | | A T G G C G G A G A G C G | | | T T G A C G C T A G A CGCCGTGAGGTGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |