Sequence ID | >WENV170727187 |
Genome ID | LSQX01407774 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1478 |
End posion on genome | 1393 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ataaaaatta |
tRNA gene sequence |
GCCGCGGTGGCGGAATTGGTAGACGCGTGGGTCTCAAAAACCCATGAGTTAAATACTTGT |
Downstream region at tRNA end position |
actttttaac |
Secondary structure (Cloverleaf model) | >WENV170727187 Leu CAA a ACag actttttaac G - C C - G C - G G - C C - G G - C G - C T T T C A C T C A T A A G | | | | | G T G G C G G T G A G C G | | | T T G A C G C T A G G TGAGTTAAATACTTGT T - A G - C G - C G - C T - A C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |