Sequence ID | >WENV170727191 |
Genome ID | LSQX01408114 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 12615 |
End posion on genome | 12689 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
tagttgattt |
tRNA gene sequence |
GTCTCGGTAGTCCAATGGATAAGACGGTGGATTCCGGTTCCACTGATACGGGTTCGATTC |
Downstream region at tRNA end position |
aatgtctaaa |
Secondary structure (Cloverleaf model) | >WENV170727191 Arg CCG t GCCA aatgtctaaa G - C T - A C - G T + G C - G G - C G - C T T T T G T C C A T A A A | | + | | G G C C T G A C G G G C G | | | T T A A G A C T A G TGAT G - C T - A G - C G - C A - T T T T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |