| Sequence ID | >WENV170763498 |
| Genome ID | LWDU01011110 |
| Phylum/Class | [LWDU] hydrothermal vent metagenome; deep sea hydrothermal plume seawater |
| Species | |
| Start position on genome | 2577 |
| End posion on genome | 2652 |
| Amino Acid | Ala |
| Anticodon | GGC |
| Upstream region at tRNA start position |
ctgccaagag |
| tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCAACACTGGCAGTGTTGAGGTCAGCGGTTCGATC |
| Downstream region at tRNA end position |
attttggtga |
| Secondary structure (Cloverleaf model) | >WENV170763498 Ala GGC
g ACCA attttggtga
G - C
G - C
G + T
G - C
C - G
C - G
A - T C T
T T C G C C A
C G A A | | | | | G
T C T C G A G C G G C
G | | | | T T
G G A G C
G A G AGGTC
C - G
A - T
A - T
C - G
A - T
C G
T A
G G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |