| Sequence ID | >WENV170766292 |
| Genome ID | LWDU01041255 |
| Phylum/Class | [LWDU] hydrothermal vent metagenome; deep sea hydrothermal plume seawater |
| Species | |
| Start position on genome | 5490 |
| End posion on genome | 5565 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
tgctgtttaa |
| tRNA gene sequence |
ACGGGTGTAGCTCAATTGGTAGAGTAGTGGTCTCCAAAACCATTGGCTGGGAGTTCGAGT |
| Downstream region at tRNA end position |
gaagagaaaa |
| Secondary structure (Cloverleaf model) | >WENV170766292 Trp CCA
a GCTA gaagagaaaa
A - T
C - G
G - C
G - C
G - C
T - A
G - C T G
T C T C T C A
T A A A | + | | | G
T C T C G G G G A G C
G | | | + T T
G G A G T
T A A TGGCT
G + T
T - A
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |