The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At2115
Genome IDAE017199
Search identical group
Phylum/ClassNanoarchaeota
SpeciesNanoarchaeum equitans Kin4-M [AE017199]
Start position on genome 225624
End posion on genome 225716
Amino Acid Ile
Anticodon TAT
Upstream region at tRNA start position
atctgtcact
tRNA gene sequence
GGGCCCGTGGCTCAGCCTGGGAGAGCGCCGGCCTTATAAGCCGGAGGTCCCGGGTTCGAA
TCCCGGCGGGCCCActt
Downstream region at tRNA end position
ttaaatctct
Secondary structure (Cloverleaf model)
>At2115	Ile	TAT
                   t      Actt ttaaatctct
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      C G A        G      | | | | |     G
    C       C T C G       C C G G G     C
    T       | | | |                 T T
    G       G A G C
      G G A        G     AGGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A *
                    T A T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb. tRNA-Met(Ile) whose CAU anticodon is enzymatically converted to read AUA codons.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK