The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0494
Genome IDAE006641
Search identical group
Phylum/ClassThermoproteota
SpeciesSaccharolobus solfataricus P2 [AE006641]
Start position on genome 184880
End posion on genome 184778
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ggggtaaagt
tRNA gene sequence
AGCGGGGTGGGCTAGCCTGGTAAGGCCGCGGGGCTCATAACCCCGAGGTCCCTGGTTCAA
ATCCAGGCCCCGCTACCA
Downstream region at tRNA end position
tattatttct
Secondary structure (Cloverleaf model)
>At0494	Met	CAT
                   t      ACCA tattatttct
                     A - T
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     G G A C C     A
    C C G A        G      | | | | |     A
  T         T C G G       C C T G G     C
  G         + | | |                 T T
  G         G G C C
    T A A          G     AGGTC
                    C - G
                    G - C
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A *
                    C A T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb. tRNA-Met(initiator).
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK