The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0769
Genome IDAY596297
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHaloarcula marismortui ATCC 43049 [AY596297, AY596298]
Start position on genome 3104223
End posion on genome 3104297
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
acgaagaagt
tRNA gene sequence
AGCGGGATGGGATAGCCAGGAGATTCCGGCGGGCTCATAACCCGCAGATCGGTAGTTCAA
ATCTACCTCCCGCTAtca
Downstream region at tRNA end position
ttttgccgaa
Secondary structure (Cloverleaf model)
>At0769	Met	CAT
                   t      Atca ttttgccgaa
                     A - T
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T          T A
                    T     C C A T C     A
    C C G A        G      | | | | |     A
  A         T A G G       G G T A G     C
  G           | | |                 T T
  G         T T C C
    A G A          G     AGATC
                    G - C
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb. tRNA-Met(initiator).
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK