The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0821
Genome IDAE004437
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHalobacterium salinarum NRC-1; ATCC 700922 [AE004437]
Start position on genome 430222
End posion on genome 430148
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
atggattgat
tRNA gene sequence
AGCGGGATGGGATAGCCAGGAGATTCCGCCGGGCTCATAACCCGGAGATCGGTAGTTCAA
ATCTACCTCCCGCTActc
Downstream region at tRNA end position
ctctggaact
Secondary structure (Cloverleaf model)
>At0821	Met	CAT
                   t      Actc ctctggaact
                     A - T
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T          T A
                    T     C C A T C     A
    C C G A        G      | | | | |     A
  A         T A G G       G G T A G     C
  G           | | |                 T T
  G         T T C C
    A G A          G     AGATC
                    C - G
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb. tRNA-Met(initiator).
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK