The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0988
Genome IDCP000300
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcoides burtonii DSM 6242 [CP000300]
Start position on genome 124387
End posion on genome 124313
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
actcactctt
tRNA gene sequence
AGCGGGGTGGGGTAGCCAGGAGATCCCGACGGGCTCATAACCCGTAGACCGATGGTTCGA
ATCCATCCCCCGCTAttc
Downstream region at tRNA end position
aatctactat
Secondary structure (Cloverleaf model)
>At0988	Met	CAT
                   t      Attc aatctactat
                     A - T
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C T A C C     A
    C C G A        G      | | | | |     G
  A         T G G G       G A T G G     C
  G           | | |                 T T
  G         T C C C
    A G A          G     AGACC
                    A - T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb. tRNA-Met(initiator).
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK