The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1009
Genome IDCP000743
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus aeolicus Nankai-3 [CP000743]
Start position on genome 766012
End posion on genome 766087
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
taagataatt
tRNA gene sequence
AGCGAGGTAGGGTAGCCAGGCCCATCCCGCCGGGCTCATAACCCGGAGATCCGAAGTTCG
AATCTTCGCCTCGCTAttt
Downstream region at tRNA end position
ttttatgtaa
Secondary structure (Cloverleaf model)
>At1009	Met	CAT
                   t      Attt ttttatgtaa
                     A - T
                     G - C
                     C - G
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     G C T T C     A
    C C G A        A      | | | | |     G
  A         T G G G       C G A A G     C
  G           | | |                 T T
  G         T C C C
    C C C A        G     AGATC
                    C - G
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb. tRNA-Met(initiator).
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK