The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1192
Genome IDCP000742
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus vannielii SB [CP000742]
Start position on genome 1403687
End posion on genome 1403612
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
aaatcagcga
tRNA gene sequence
AGCGAGGTAGGGTAGCCAGGCCTATCCCGCCGGGCTCATAACCCGGAGACCAGAAGTTCA
AATCTTCTCCTCGCTAttt
Downstream region at tRNA end position
ttaattaaat
Secondary structure (Cloverleaf model)
>At1192	Met	CAT
                   a      Attt ttaattaaat
                     A - T
                     G - C
                     C - G
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     T C T T C     A
    C C G A        A      | | | | |     A
  A         T G G G       A G A A G     C
  G           | | |                 T T
  G         T C C C
    C C T A        G     AGACC
                    C - G
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb. tRNA-Met(initiator).
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK