The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1401
Genome IDAE010299
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina acetivorans C2A [AE010299]
Start position on genome 5648188
End posion on genome 5648262
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
agaacactgt
tRNA gene sequence
AGCGGGGTGGGGTAGCCAGGAGATCCCGACGGGCTCATAACCCGTAGACCGATGGTTCGA
ATCCATCCCCCGCTAtaa
Downstream region at tRNA end position
agagattttt
Secondary structure (Cloverleaf model)
>At1401	Met	CAT
                   t      Ataa agagattttt
                     A - T
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C T A C C     A
    C C G A        G      | | | | |     G
  A         T G G G       G A T G G     C
  G           | | |                 T T
  G         T C C C
    A G A          G     AGACC
                    A - T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb. tRNA-Met(initiator).
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK