The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1438
Genome IDCP000099
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosarcina barkeri [CP000099]
Start position on genome 1110029
End posion on genome 1110103
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
aaaaccttgt
tRNA gene sequence
AGCGGGGTGGGGTAGCCAGGAGATCCCGACGGGCTCATAACCCGTAGACCGATGGTTCGA
ATCCATCCCCCGCTAtag
Downstream region at tRNA end position
taaagctctt
Secondary structure (Cloverleaf model)
>At1438	Met	CAT
                   t      Atag taaagctctt
                     A - T
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C T A C C     A
    C C G A        G      | | | | |     G
  A         T G G G       G A T G G     C
  G           | | |                 T T
  G         T C C C
    A G A          G     AGACC
                    A - T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb. tRNA-Met(initiator).
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK